BLASTN 2.0.5 [May-5-1998]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= DXRat8
         (406 letters)

Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq
           62,851 sequences; 45,673,593 total letters

Searching.................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gnl|UG|Hs.3383 Human mRNA for KIAA0312 gene, partial cds /cds=(...   103  1e-21
gnl|UG|Hs.163274 H.sapiens clathrin light chain a gene /cds=UNK...    60  2e-08
gnl|UG|Hs.54426 Human pancreatic polypeptide receptor mRNA, com...    52  4e-06
gnl|UG|Hs.44806 Homo sapiens zinc finger protein (MBLL) mRNA, c...    48  6e-05
gnl|UG|Hs.106876 ATPase, H+ transporting, lysosomal (vacuolar p...    42  0.004

>gnl|UG|Hs.3383 Human mRNA for KIAA0312 gene, partial cds
            /cds=(0,5721) /gb=AB002310 /gi=2224564 /len=5842
            Length = 5842
            
 Score =  103 bits (52), Expect = 1e-21
 Identities = 70/76 (92%), Positives = 70/76 (92%)

                                                                        
Query: 35   actacaggtcatcatccagctgcgggatgacacacgacgagctaacaaaaaagccaagca 94
            ||||||||||||||||||||| ||||| ||||| || || |||||||| |||||||||||
Sbjct: 3775 actacaggtcatcatccagctccgggacgacacgcgccgggctaacaagaaagccaagca 3834

                            
Query: 95   gacaggcaggctaggt 110
            ||||||||||||||||
Sbjct: 3835 gacaggcaggctaggt 3850


>gnl|UG|Hs.163274 H.sapiens clathrin light chain a gene /cds=UNKNOWN
            /gb=X81636 /gi=704460 /len=2737
            Length = 2737
            
 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 30/30 (100%), Positives = 30/30 (100%)

                                          
Query: 2    tgcatgcctgcaggtcgactctagaggatc 31
            ||||||||||||||||||||||||||||||
Sbjct: 2708 tgcatgcctgcaggtcgactctagaggatc 2737


>gnl|UG|Hs.54426 Human pancreatic polypeptide receptor mRNA, complete
            cds /cds=(85,1212) /gb=U42387 /gi=1314327 /len=1673
            Length = 1673
            
 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 26/26 (100%), Positives = 26/26 (100%)

                                      
Query: 2    tgcatgcctgcaggtcgactctagag 27
            ||||||||||||||||||||||||||
Sbjct: 1641 tgcatgcctgcaggtcgactctagag 1616


>gnl|UG|Hs.44806 Homo sapiens zinc finger protein (MBLL) mRNA,
            complete cds /cds=(782,1549) /gb=AF061261 /gi=3779239
            /len=2595
            Length = 2595
            
 Score = 48.1 bits (24), Expect = 6e-05
 Identities = 24/24 (100%), Positives = 24/24 (100%)

                                    
Query: 3    gcatgcctgcaggtcgactctaga 26
            ||||||||||||||||||||||||
Sbjct: 2595 gcatgcctgcaggtcgactctaga 2572


>gnl|UG|Hs.106876 ATPase, H+ transporting, lysosomal (vacuolar proton
            pump) 31kD /cds=(256,1080) /gb=X71490 /gi=313011
            /len=1630
            Length = 1630
            
 Score = 42.1 bits (21), Expect = 0.004
 Identities = 21/21 (100%), Positives = 21/21 (100%)

                                 
Query: 9    ctgcaggtcgactctagagga 29
            |||||||||||||||||||||
Sbjct: 1628 ctgcaggtcgactctagagga 1608


  Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq
    Posted date:  Mar 4, 1999  1:26 AM
  Number of letters in database: 45,673,593
  Number of sequences in database:  62,851
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7109
Number of Sequences: 62851
Number of extensions: 7109
Number of successful extensions: 2000
Number of sequences better than 10: 21
length of query: 406
length of database: 45673593
effective HSP length: 17
effective length of query: 389
effective length of database: 44605126
effective search space: 17351394014
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 0 ( 0.5 bits)
S2: 16 (32.2 bits)