BLASTN 2.0.5 [May-5-1998]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= D9Rat36
         (544 letters)

Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq
           62,851 sequences; 45,673,593 total letters

Searching.................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gnl|UG|Hs.156007 ZAKI-4 mRNA in human skin fibroblast, complete...   131  7e-30
gnl|UG|Hs.28944 ng61b03.s1 Homo sapiens cDNA /clone=IMAGE:93924...    42  0.005
gnl|UG|Hs.141425 yx28e02.s1 Homo sapiens cDNA, 3' end /clone=IM...    38  0.076
gnl|UG|Hs.123725 yw39a08.s1 Homo sapiens cDNA, 3' end /clone=IM...    36  0.30
gnl|UG|Hs.152832 ac05d04.s1 Homo sapiens cDNA, 3' end /clone=IM...    32  4.7

>gnl|UG|Hs.156007 ZAKI-4 mRNA in human skin fibroblast, complete cds
            /cds=(204,782) /gb=D83407 /gi=1435039 /len=3184
            Length = 3184
            
 Score =  131 bits (66), Expect = 7e-30
 Identities = 96/105 (91%), Positives = 96/105 (91%), Gaps = 1/105 (0%)

                                                                        
Query: 286  cctggccacttatataggaccataagtaa-ctnggctttgactgcatgagatccccctat 344
            |||||||||||| ||||||||||| |||| || | |||||||||||||||||  ||||||
Sbjct: 1155 cctggccacttaaataggaccatatgtaaacttgactttgactgcatgagatatccctat 1214

                                                         
Query: 345  ctggtctcacccagtcctctgcatcccgacattcccaggacatgc 389
            |||||||||| |||||||||||||||| |||||||||||||||||
Sbjct: 1215 ctggtctcactcagtcctctgcatcccaacattcccaggacatgc 1259


>gnl|UG|Hs.28944 ng61b03.s1 Homo sapiens cDNA /clone=IMAGE:939245
           /gb=AA494061 /gi=2223902 /len=460
           Length = 460
           
 Score = 42.1 bits (21), Expect = 0.005
 Identities = 21/21 (100%), Positives = 21/21 (100%)

                                
Query: 182 tacaggtgtacaccaccaaac 202
           |||||||||||||||||||||
Sbjct: 262 tacaggtgtacaccaccaaac 282


>gnl|UG|Hs.141425 yx28e02.s1 Homo sapiens cDNA, 3' end
           /clone=IMAGE:263066 /clone_end=3' /gb=N20050 /gi=1124717
           /len=424
           Length = 424
           
 Score = 38.2 bits (19), Expect = 0.076
 Identities = 22/23 (95%), Positives = 22/23 (95%)

                                  
Query: 177 ggaattacaggtgtacaccacca 199
           |||||||||||||| ||||||||
Sbjct: 156 ggaattacaggtgtgcaccacca 178


>gnl|UG|Hs.123725 yw39a08.s1 Homo sapiens cDNA, 3' end
           /clone=IMAGE:254582 /clone_end=3' /gb=N22415 /gi=1128549
           /len=454
           Length = 454
           
 Score = 36.2 bits (18), Expect = 0.30
 Identities = 18/18 (100%), Positives = 18/18 (100%)

                             
Query: 135 gttcacagagagccatct 152
           ||||||||||||||||||
Sbjct: 363 gttcacagagagccatct 380


>gnl|UG|Hs.152832 ac05d04.s1 Homo sapiens cDNA, 3' end
           /clone=IMAGE:855559 /clone_end=3' /gb=AA664211
           /gi=2618202 /len=460
           Length = 460
           
 Score = 32.2 bits (16), Expect = 4.7
 Identities = 19/20 (95%), Positives = 19/20 (95%)

                               
Query: 180 attacaggtgtacaccacca 199
           ||||||||||| ||||||||
Sbjct: 365 attacaggtgtgcaccacca 346


  Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq
    Posted date:  Mar 4, 1999  1:26 AM
  Number of letters in database: 45,673,593
  Number of sequences in database:  62,851
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 11333
Number of Sequences: 62851
Number of extensions: 11333
Number of successful extensions: 878
Number of sequences better than 10: 33
length of query: 544
length of database: 45673593
effective HSP length: 18
effective length of query: 526
effective length of database: 44542275
effective search space: 23429236650
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 0 ( 0.5 bits)
S2: 16 (32.2 bits)