BLASTN 2.0.5 [May-5-1998]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= D8Rat83
         (381 letters)

Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq
           62,851 sequences; 45,673,593 total letters

Searching.................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gnl|UG|Hs.32770 Homo sapiens SP1-like zinc finger transcription...   105  3e-22
gnl|UG|Hs.87306 ob67d07.s1 Homo sapiens cDNA /clone=IMAGE:13364...    38  0.053
gnl|UG|Hs.77890 H.sapiens soluble guanylate cyclase small subun...    38  0.053
gnl|UG|Hs.137560 nz61g03.s1 Homo sapiens cDNA /clone=IMAGE:1299...    36  0.21
gnl|UG|Hs.83727 Human cleavage and polyadenylation specificity ...    36  0.21

>gnl|UG|Hs.32770 Homo sapiens SP1-like zinc finger transcription
           factor (TIEG2) mRNA, complete cds /cds=(17,1555)
           /gb=AF028008 /gi=3334452 /len=1796
           Length = 1796
           
 Score =  105 bits (53), Expect = 3e-22
 Identities = 74/81 (91%), Positives = 74/81 (91%)

                                                                       
Query: 300 agcttcgatatctgtctgctccaggatgctgcacgtggacctttcgctgtcgtgccgctt 359
           |||||| || ||||||||||||| ||||||||| || |||||||||||||| ||||||||
Sbjct: 158 agcttccatgtctgtctgctccaagatgctgcaagtagacctttcgctgtcatgccgctt 99

                                
Query: 360 cctctccaggattgactcaca 380
           |||||||||||| ||||||||
Sbjct: 98  cctctccaggatggactcaca 78


>gnl|UG|Hs.87306 ob67d07.s1 Homo sapiens cDNA /clone=IMAGE:1336429
           /gb=AA810981 /gi=2880592 /len=415
           Length = 415
           
 Score = 38.2 bits (19), Expect = 0.053
 Identities = 19/19 (100%), Positives = 19/19 (100%)

                              
Query: 191 aaaataaatgtgttttgca 209
           |||||||||||||||||||
Sbjct: 51  aaaataaatgtgttttgca 33


>gnl|UG|Hs.77890 H.sapiens soluble guanylate cyclase small subunit
           mRNA /cds=(88,1947) /gb=X66533 /gi=31685 /len=2443
           Length = 2443
           
 Score = 38.2 bits (19), Expect = 0.053
 Identities = 25/27 (92%), Positives = 25/27 (92%)

                                      
Query: 257 tcataaaaatcctctgcttttgcctct 283
           ||||||||||||||| |||||| ||||
Sbjct: 666 tcataaaaatcctcttcttttgactct 640


>gnl|UG|Hs.137560 nz61g03.s1 Homo sapiens cDNA /clone=IMAGE:1299988
           /gb=AA764860 /gi=2816098 /len=328
           Length = 328
           
 Score = 36.2 bits (18), Expect = 0.21
 Identities = 18/18 (100%), Positives = 18/18 (100%)

                             
Query: 247 agtttcaaaatcataaaa 264
           ||||||||||||||||||
Sbjct: 64  agtttcaaaatcataaaa 47


>gnl|UG|Hs.83727 Human cleavage and polyadenylation specificity factor
            mRNA, complete cds /cds=(51,4379) /gb=U37012 /gi=1045573
            /len=4463
            Length = 4463
            
 Score = 36.2 bits (18), Expect = 0.21
 Identities = 18/18 (100%), Positives = 18/18 (100%)

                              
Query: 323  ggatgctgcacgtggacc 340
            ||||||||||||||||||
Sbjct: 4193 ggatgctgcacgtggacc 4210


  Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq
    Posted date:  Mar 4, 1999  1:26 AM
  Number of letters in database: 45,673,593
  Number of sequences in database:  62,851
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 12124
Number of Sequences: 62851
Number of extensions: 12124
Number of successful extensions: 3351
Number of sequences better than 10: 29
length of query: 381
length of database: 45673593
effective HSP length: 17
effective length of query: 364
effective length of database: 44605126
effective search space: 16236265864
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 0 ( 0.5 bits)
S2: 16 (32.2 bits)