BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= D4Rat112 (486 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,851 sequences; 45,673,593 total letters Searching.................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.99542 yu27g05.r1 Homo sapiens cDNA, 5' end /clone=IMA... 40 0.017 gnl|UG|Hs.1948 H.sapiens 8.2kDa differentiation factor mRNA /cd... 38 0.068 gnl|UG|Hs.128795 ab09a11.s1 Homo sapiens cDNA, 3' end /clone=IM... 38 0.068 gnl|UG|Hs.163274 H.sapiens clathrin light chain a gene /cds=UNK... 38 0.068 gnl|UG|Hs.141003 yi73g09.r1 Homo sapiens cDNA, 3' end /clone=IM... 36 0.27 >gnl|UG|Hs.99542 yu27g05.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:235064 /clone_end=5' /gb=H79238 /gi=1057327 /len=459 Length = 459 Score = 40.1 bits (20), Expect = 0.017 Identities = 20/20 (100%), Positives = 20/20 (100%) Query: 344 acaaataaaacaaaaatttt 363 |||||||||||||||||||| Sbjct: 236 acaaataaaacaaaaatttt 217 >gnl|UG|Hs.1948 H.sapiens 8.2kDa differentiation factor mRNA /cds=(60,353) /gb=X79563 /gi=499069 /len=465 Length = 465 Score = 38.2 bits (19), Expect = 0.068 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 5 cgactctagaggatccccc 23 ||||||||||||||||||| Sbjct: 10 cgactctagaggatccccc 28 >gnl|UG|Hs.128795 ab09a11.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:840284 /clone_end=3' /gb=AA485312 /gi=2214531 /len=416 Length = 416 Score = 38.2 bits (19), Expect = 0.068 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 348 ataaaacaaaaattttaaa 366 ||||||||||||||||||| Sbjct: 136 ataaaacaaaaattttaaa 154 >gnl|UG|Hs.163274 H.sapiens clathrin light chain a gene /cds=UNKNOWN /gb=X81636 /gi=704460 /len=2737 Length = 2737 Score = 38.2 bits (19), Expect = 0.068 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 1 aggtcgactctagaggatc 19 ||||||||||||||||||| Sbjct: 2719 aggtcgactctagaggatc 2737 >gnl|UG|Hs.141003 yi73g09.r1 Homo sapiens cDNA, 3' end /clone=IMAGE:144928 /clone_end=3' /gb=R78603 /gi=854884 /len=448 Length = 448 Score = 36.2 bits (18), Expect = 0.27 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 346 aaataaaacaaaaatttt 363 |||||||||||||||||| Sbjct: 413 aaataaaacaaaaatttt 430 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Mar 4, 1999 1:26 AM Number of letters in database: 45,673,593 Number of sequences in database: 62,851 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 11087 Number of Sequences: 62851 Number of extensions: 11087 Number of successful extensions: 3153 Number of sequences better than 10: 33 length of query: 486 length of database: 45673593 effective HSP length: 17 effective length of query: 469 effective length of database: 44605126 effective search space: 20919804094 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)