BLASTN 2.0.5 [May-5-1998] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= D18Rat36 (372 letters) Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq 62,851 sequences; 45,673,593 total letters Searching.................................................done Score E Sequences producing significant alignments: (bits) Value gnl|UG|Hs.148840 qu40c09.x1 Homo sapiens cDNA, 3' end /clone=IM... 42 0.003 gnl|UG|Hs.125235 zv63h03.s1 Homo sapiens cDNA, 3' end /clone=IM... 38 0.052 gnl|UG|Hs.73793 Homo sapiens vascular endothelial growth factor... 38 0.052 gnl|UG|Hs.138500 yq16a07.r1 Homo sapiens cDNA, 5' end /clone=IM... 36 0.20 gnl|UG|Hs.86149 qx90f05.x1 Homo sapiens cDNA, 3' end /clone=IMA... 36 0.20 >gnl|UG|Hs.148840 qu40c09.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:1967248 /clone_end=3' /gb=AI240237 /gi=3835634 /len=366 Length = 366 Score = 42.1 bits (21), Expect = 0.003 Identities = 27/29 (93%), Positives = 27/29 (93%) Query: 169 tgcattattttatatatataaaattttta 197 ||||||| ||||| ||||||||||||||| Sbjct: 203 tgcattagtttatttatataaaattttta 231 >gnl|UG|Hs.125235 zv63h03.s1 Homo sapiens cDNA, 3' end /clone=IMAGE:758357 /clone_end=3' /gb=AA404261 /gi=2059020 /len=511 Length = 511 Score = 38.2 bits (19), Expect = 0.052 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 119 atggctttattttgctatc 137 ||||||||||||||||||| Sbjct: 29 atggctttattttgctatc 47 >gnl|UG|Hs.73793 Homo sapiens vascular endothelial growth factor mRNA, complete cds /cds=(701,1276) /gb=AF022375 /gi=3719220 /len=3154 Length = 3154 Score = 38.2 bits (19), Expect = 0.052 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 174 tattttatatatataaaat 192 ||||||||||||||||||| Sbjct: 1677 tattttatatatataaaat 1695 Score = 38.2 bits (19), Expect = 0.052 Identities = 19/19 (100%), Positives = 19/19 (100%) Query: 174 tattttatatatataaaat 192 ||||||||||||||||||| Sbjct: 1696 tattttatatatataaaat 1678 >gnl|UG|Hs.138500 yq16a07.r1 Homo sapiens cDNA, 5' end /clone=IMAGE:197076 /clone_end=5' /gb=R93444 /gi=967610 /len=477 Length = 477 Score = 36.2 bits (18), Expect = 0.20 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 179 tatatatataaaattttt 196 |||||||||||||||||| Sbjct: 432 tatatatataaaattttt 415 >gnl|UG|Hs.86149 qx90f05.x1 Homo sapiens cDNA, 3' end /clone=IMAGE:2009793 /clone_end=3' /gb=AI341312 /len=570 Length = 570 Score = 36.2 bits (18), Expect = 0.20 Identities = 18/18 (100%), Positives = 18/18 (100%) Query: 180 atatatataaaattttta 197 |||||||||||||||||| Sbjct: 143 atatatataaaattttta 160 Database: /ddhome/DDsys/GenDB/UniGeneHs/Hs.seq.uniq Posted date: Mar 4, 1999 1:26 AM Number of letters in database: 45,673,593 Number of sequences in database: 62,851 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 17161 Number of Sequences: 62851 Number of extensions: 17161 Number of successful extensions: 3865 Number of sequences better than 10: 46 length of query: 372 length of database: 45673593 effective HSP length: 17 effective length of query: 355 effective length of database: 44605126 effective search space: 15834819730 T: 0 A: 0 X1: 6 (11.9 bits) X2: 25 (49.6 bits) S1: 0 ( 0.5 bits) S2: 16 (32.2 bits)